ID: 1191616779_1191616785

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1191616779 1191616785
Species Human (GRCh38) Human (GRCh38)
Location X:63177628-63177650 X:63177662-63177684
Sequence CCACATCAAGGGAACACCCCATG TCTGGAGAGCAGGCCTTGAGTGG
Strand - +
Off-target summary {0: 15, 1: 78, 2: 144, 3: 215, 4: 320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!