ID: 1191619507_1191619515

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1191619507 1191619515
Species Human (GRCh38) Human (GRCh38)
Location X:63201241-63201263 X:63201278-63201300
Sequence CCCACCAGTGGAAGGACCTGCCA TCCAGATTCTTTTGTCTCATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!