ID: 1191620395_1191620401

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1191620395 1191620401
Species Human (GRCh38) Human (GRCh38)
Location X:63209992-63210014 X:63210020-63210042
Sequence CCTGTCCCCCTTCTCTCAGGGGC ACTCCACAGGATAGATTGTCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 15, 4: 281} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!