ID: 1191683729_1191683734

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1191683729 1191683734
Species Human (GRCh38) Human (GRCh38)
Location X:63867705-63867727 X:63867756-63867778
Sequence CCTAAATGGCCACCAACTGAGTC GATGCGTAATGTAAAGTATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!