ID: 1191784594_1191784603

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1191784594 1191784603
Species Human (GRCh38) Human (GRCh38)
Location X:64903779-64903801 X:64903806-64903828
Sequence CCCCTATACTGGCCAATATAACC TCTATGTGGGGTGATTTCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!