ID: 1191805979_1191805982

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1191805979 1191805982
Species Human (GRCh38) Human (GRCh38)
Location X:65134238-65134260 X:65134261-65134283
Sequence CCAAAGCAAGCATCCCAGCAATT GACTTGCCACCAAGAGAACGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!