ID: 1191894141_1191894150

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1191894141 1191894150
Species Human (GRCh38) Human (GRCh38)
Location X:65975223-65975245 X:65975237-65975259
Sequence CCTCACCTCCCAGACGGGGTGGC CGGGGTGGCGGCGGGGCAGAGGG
Strand - +
Off-target summary {0: 347, 1: 3636, 2: 6174, 3: 6475, 4: 8533} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!