ID: 1192058018_1192058029

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1192058018 1192058029
Species Human (GRCh38) Human (GRCh38)
Location X:67793091-67793113 X:67793116-67793138
Sequence CCAAGCCTGGCTCCTCTTCTGTG CTGGGGAGGGAGCATGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 10, 3: 130, 4: 1030}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!