ID: 1192147810_1192147818

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1192147810 1192147818
Species Human (GRCh38) Human (GRCh38)
Location X:68693709-68693731 X:68693724-68693746
Sequence CCCTGCCCGACCCCAGGCCCCGC GGCCCCGCGTGTGTCCCGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 98, 4: 785} {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!