ID: 1192203499_1192203509

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1192203499 1192203509
Species Human (GRCh38) Human (GRCh38)
Location X:69081861-69081883 X:69081877-69081899
Sequence CCCCTGCACCCGCCCACCCCCAG CCCCCAGAGGCAGTGTCCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!