ID: 1192211229_1192211234

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1192211229 1192211234
Species Human (GRCh38) Human (GRCh38)
Location X:69129132-69129154 X:69129176-69129198
Sequence CCTCTCTCTTGAGTCTGTGCTTG GCTCCCCAGCTCTTTCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 375} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!