ID: 1192254301_1192254306

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1192254301 1192254306
Species Human (GRCh38) Human (GRCh38)
Location X:69442855-69442877 X:69442868-69442890
Sequence CCAGGGGTTCCCTGTCTGGTGAT GTCTGGTGATGAGCTCTGAGGGG
Strand - +
Off-target summary {0: 11, 1: 34, 2: 35, 3: 51, 4: 189} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!