ID: 1192493643_1192493650

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1192493643 1192493650
Species Human (GRCh38) Human (GRCh38)
Location X:71598385-71598407 X:71598415-71598437
Sequence CCCCGCTCTATGTGTGGGAATGA GAGGAAAGGAGTAAGAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84} {0: 1, 1: 0, 2: 3, 3: 64, 4: 790}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!