ID: 1192520464_1192520478

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1192520464 1192520478
Species Human (GRCh38) Human (GRCh38)
Location X:71796215-71796237 X:71796258-71796280
Sequence CCAGGCCCACCTCATCACCAGGC TCCAGACTGGTCCCATGGCCAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 5, 3: 57, 4: 417} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!