ID: 1192634397_1192634404

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1192634397 1192634404
Species Human (GRCh38) Human (GRCh38)
Location X:72804131-72804153 X:72804177-72804199
Sequence CCAGCAGTCTTCCGACTGTTCTC AATTACCTCAGGTGACCATGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 9, 4: 113} {0: 2, 1: 0, 2: 0, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!