ID: 1192765644_1192765651

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1192765644 1192765651
Species Human (GRCh38) Human (GRCh38)
Location X:74137322-74137344 X:74137373-74137395
Sequence CCACCCATAGACTCTTTAGCCTC GATGTCCTTACAGCTGAAGTAGG
Strand - +
Off-target summary No data {0: 5, 1: 5, 2: 4, 3: 23, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!