ID: 1192999509_1192999513

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1192999509 1192999513
Species Human (GRCh38) Human (GRCh38)
Location X:76549520-76549542 X:76549552-76549574
Sequence CCAAAATTGACACCCTAACATCA GAACTGGATTTATCTACTTTTGG
Strand - +
Off-target summary {0: 3374, 1: 944, 2: 244, 3: 60, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!