ID: 1192999511_1192999513

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1192999511 1192999513
Species Human (GRCh38) Human (GRCh38)
Location X:76549533-76549555 X:76549552-76549574
Sequence CCTAACATCACAATTAAAAGAAC GAACTGGATTTATCTACTTTTGG
Strand - +
Off-target summary {0: 7382, 1: 3708, 2: 1613, 3: 893, 4: 1654} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!