ID: 1193040540_1193040551

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1193040540 1193040551
Species Human (GRCh38) Human (GRCh38)
Location X:76999266-76999288 X:76999313-76999335
Sequence CCACCCTACTTCTGCTTACCCTG CAGTTCCAATGAGATGAACCGGG
Strand - +
Off-target summary No data {0: 17, 1: 427, 2: 918, 3: 890, 4: 1086}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!