ID: 1193286578_1193286584

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1193286578 1193286584
Species Human (GRCh38) Human (GRCh38)
Location X:79721921-79721943 X:79721943-79721965
Sequence CCTTGGCTGTTCTCTCAGCTCAC CCCTAATGGGTGGCTCATGGCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 11, 3: 48, 4: 352} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!