ID: 1193290149_1193290153

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1193290149 1193290153
Species Human (GRCh38) Human (GRCh38)
Location X:79762879-79762901 X:79762902-79762924
Sequence CCCCTCTTATACTTTGGGCACTC ACAGTTTTTTGGCTGTTTTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 17, 3: 67, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!