ID: 1193500455_1193500457

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1193500455 1193500457
Species Human (GRCh38) Human (GRCh38)
Location X:82267589-82267611 X:82267616-82267638
Sequence CCGGAGATGTATAGAAATTCTAG TTGTAATTTTTGAGGAAAGAAGG
Strand - +
Off-target summary {0: 23, 1: 33, 2: 30, 3: 26, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!