ID: 1193580056_1193580063

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1193580056 1193580063
Species Human (GRCh38) Human (GRCh38)
Location X:83252905-83252927 X:83252931-83252953
Sequence CCCTGTCTGATATGAATAGCCAG ACTGGGTCAGGAGTATGACTGGG
Strand - +
Off-target summary No data {0: 3, 1: 10, 2: 29, 3: 37, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!