ID: 1193760780_1193760785

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1193760780 1193760785
Species Human (GRCh38) Human (GRCh38)
Location X:85462829-85462851 X:85462859-85462881
Sequence CCTATCTGACTGAAGTGCACTTG AGGAAACATCAGAAGTAGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!