ID: 1193927068_1193927069

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1193927068 1193927069
Species Human (GRCh38) Human (GRCh38)
Location X:87500487-87500509 X:87500515-87500537
Sequence CCAACACTATGTTGAACATGGAC GTCTAAAACACCAAAAGCAATGG
Strand - +
Off-target summary No data {0: 9694, 1: 7889, 2: 2856, 3: 966, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!