ID: 1193957298_1193957303

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1193957298 1193957303
Species Human (GRCh38) Human (GRCh38)
Location X:87878325-87878347 X:87878360-87878382
Sequence CCCATCTAACCACAAAGTGGGTC ATTCCATCATCAAATGGAAGTGG
Strand - +
Off-target summary No data {0: 167, 1: 211, 2: 137, 3: 138, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!