ID: 1193972449_1193972453

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1193972449 1193972453
Species Human (GRCh38) Human (GRCh38)
Location X:88072021-88072043 X:88072041-88072063
Sequence CCACCATGCCTAGCTAATTTTTG TTGTATTTTCAGTAAAGGCGAGG
Strand - +
Off-target summary {0: 1253, 1: 45091, 2: 121441, 3: 194165, 4: 195727} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!