ID: 1193972450_1193972453

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1193972450 1193972453
Species Human (GRCh38) Human (GRCh38)
Location X:88072024-88072046 X:88072041-88072063
Sequence CCATGCCTAGCTAATTTTTGTAT TTGTATTTTCAGTAAAGGCGAGG
Strand - +
Off-target summary {0: 1223, 1: 44183, 2: 89209, 3: 121515, 4: 116504} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!