ID: 1194604241_1194604249

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1194604241 1194604249
Species Human (GRCh38) Human (GRCh38)
Location X:95960873-95960895 X:95960907-95960929
Sequence CCAGGTAGCTGGCTGATCACCCC CCATATTGAGGGCTCAGTGTTGG
Strand - +
Off-target summary No data {0: 55, 1: 133, 2: 202, 3: 173, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!