ID: 1194756429_1194756435

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1194756429 1194756435
Species Human (GRCh38) Human (GRCh38)
Location X:97744127-97744149 X:97744157-97744179
Sequence CCCAAATCTCATATTGCATTATA TAATCCCCATGTGTCATGGGAGG
Strand - +
Off-target summary No data {0: 444, 1: 1505, 2: 3073, 3: 5002, 4: 6462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!