ID: 1194810265_1194810273

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1194810265 1194810273
Species Human (GRCh38) Human (GRCh38)
Location X:98380322-98380344 X:98380342-98380364
Sequence CCGCCATTCCCCAATCCATCCCG CCGCGCGTGCCTGCAGCCATTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!