ID: 1194875103_1194875107

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1194875103 1194875107
Species Human (GRCh38) Human (GRCh38)
Location X:99177404-99177426 X:99177454-99177476
Sequence CCAAATACTGCATGTTCTCGCTT CATGGCCTATTGAAGTATGGAGG
Strand - +
Off-target summary {0: 26, 1: 1295, 2: 3210, 3: 10223, 4: 16949} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!