ID: 1195040313_1195040317

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1195040313 1195040317
Species Human (GRCh38) Human (GRCh38)
Location X:101008153-101008175 X:101008167-101008189
Sequence CCAAGAGGAAGTTACCTTATAGG CCTTATAGGTAGTTGGATACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!