ID: 1195810708_1195810721

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1195810708 1195810721
Species Human (GRCh38) Human (GRCh38)
Location X:108825504-108825526 X:108825551-108825573
Sequence CCACCCTGCTTCTGCTTGCCCTC CAGTCCCAATGAAATGAACTGGG
Strand - +
Off-target summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307} {0: 4, 1: 142, 2: 756, 3: 1035, 4: 901}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!