|
Left Crispr |
Right Crispr |
| Crispr ID |
1195810708 |
1195810721 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:108825504-108825526
|
X:108825551-108825573
|
| Sequence |
CCACCCTGCTTCTGCTTGCCCTC |
CAGTCCCAATGAAATGAACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 67, 1: 274, 2: 555, 3: 796, 4: 1307} |
{0: 4, 1: 142, 2: 756, 3: 1035, 4: 901} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|