ID: 1195811427_1195811431

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1195811427 1195811431
Species Human (GRCh38) Human (GRCh38)
Location X:108835909-108835931 X:108835943-108835965
Sequence CCATCCACTATCTCCATTTCCAG CAAGTAACCCAATTTAAAAATGG
Strand - +
Off-target summary No data {0: 4, 1: 121, 2: 480, 3: 1377, 4: 3326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!