ID: 1195811427_1195811431 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1195811427 | 1195811431 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:108835909-108835931 | X:108835943-108835965 |
Sequence | CCATCCACTATCTCCATTTCCAG | CAAGTAACCCAATTTAAAAATGG |
Strand | - | + |
Off-target summary | No data | {0: 4, 1: 121, 2: 480, 3: 1377, 4: 3326} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |