ID: 1195846523_1195846535

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1195846523 1195846535
Species Human (GRCh38) Human (GRCh38)
Location X:109235000-109235022 X:109235045-109235067
Sequence CCAAACACCTCCCACCAGACCCC ATTCAACATGAGATTTGAGTGGG
Strand - +
Off-target summary {0: 37, 1: 678, 2: 2498, 3: 4982, 4: 6190} {0: 90, 1: 1709, 2: 11232, 3: 13453, 4: 11990}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!