ID: 1196004617_1196004627

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1196004617 1196004627
Species Human (GRCh38) Human (GRCh38)
Location X:110822405-110822427 X:110822454-110822476
Sequence CCGTGGGCGTAGGACCCTCCGAG GCGCCGTTTTTTAAGCTGGTTGG
Strand - +
Off-target summary {0: 903, 1: 1508, 2: 1213, 3: 891, 4: 695} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!