ID: 1196004623_1196004627

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1196004623 1196004627
Species Human (GRCh38) Human (GRCh38)
Location X:110822428-110822450 X:110822454-110822476
Sequence CCAGTTGCGGGATATAATCTCCT GCGCCGTTTTTTAAGCTGGTTGG
Strand - +
Off-target summary {0: 10, 1: 432, 2: 1665, 3: 1879, 4: 1703} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!