ID: 1196375753_1196375756

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1196375753 1196375756
Species Human (GRCh38) Human (GRCh38)
Location X:115030833-115030855 X:115030858-115030880
Sequence CCCTAGGCATGGCAGAACAAGTT GAGTAGCCCAAGGCCCTTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 9, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!