ID: 1196527344_1196527352

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1196527344 1196527352
Species Human (GRCh38) Human (GRCh38)
Location X:116741524-116741546 X:116741566-116741588
Sequence CCGTTGTCCCTCTCTATACCCAG TCTGCTTTCCCAAATACCAGAGG
Strand - +
Off-target summary No data {0: 59, 1: 30, 2: 19, 3: 111, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!