ID: 1196527344_1196527355

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1196527344 1196527355
Species Human (GRCh38) Human (GRCh38)
Location X:116741524-116741546 X:116741577-116741599
Sequence CCGTTGTCCCTCTCTATACCCAG AAATACCAGAGGAAGCAGAGTGG
Strand - +
Off-target summary No data {0: 57, 1: 121, 2: 79, 3: 63, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!