ID: 1196613776_1196613783

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1196613776 1196613783
Species Human (GRCh38) Human (GRCh38)
Location X:117743676-117743698 X:117743716-117743738
Sequence CCTCTGGACTCCACACCCAGGCA AGTACCCACTCTCCTGGATTAGG
Strand - +
Off-target summary No data {0: 5, 1: 10, 2: 47, 3: 54, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!