ID: 1196613776_1196613786

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1196613776 1196613786
Species Human (GRCh38) Human (GRCh38)
Location X:117743676-117743698 X:117743724-117743746
Sequence CCTCTGGACTCCACACCCAGGCA CTCTCCTGGATTAGGAGTTTAGG
Strand - +
Off-target summary No data {0: 18, 1: 38, 2: 67, 3: 73, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!