ID: 1196613777_1196613782

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1196613777 1196613782
Species Human (GRCh38) Human (GRCh38)
Location X:117743686-117743708 X:117743710-117743732
Sequence CCACACCCAGGCATATCTCCAGG ATCTTGAGTACCCACTCTCCTGG
Strand - +
Off-target summary {0: 5, 1: 35, 2: 69, 3: 169, 4: 466} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!