ID: 1196772518_1196772529

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1196772518 1196772529
Species Human (GRCh38) Human (GRCh38)
Location X:119309111-119309133 X:119309158-119309180
Sequence CCCTGCTGGATCCGGAGGGATGG CGGCAAACACCAGTGGTGGATGG
Strand - +
Off-target summary {0: 20, 1: 71, 2: 130, 3: 138, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!