ID: 1196863884_1196863891

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1196863884 1196863891
Species Human (GRCh38) Human (GRCh38)
Location X:120052786-120052808 X:120052837-120052859
Sequence CCTCCTACAGGTATAGCTCTATC CCTGGCAGCCTTCTCTCATTTGG
Strand - +
Off-target summary No data {0: 3, 1: 6, 2: 3, 3: 28, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!