ID: 1196875105_1196875114

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1196875105 1196875114
Species Human (GRCh38) Human (GRCh38)
Location X:120149555-120149577 X:120149578-120149600
Sequence CCAGGCTCCATCTTTTTAGGCCC CGGGGAGCCTATGGTCTCTATGG
Strand - +
Off-target summary No data {0: 5, 1: 2, 2: 6, 3: 7, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!