ID: 1196875105_1196875116

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1196875105 1196875116
Species Human (GRCh38) Human (GRCh38)
Location X:120149555-120149577 X:120149585-120149607
Sequence CCAGGCTCCATCTTTTTAGGCCC CCTATGGTCTCTATGGAAATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!