ID: 1196898752_1196898756

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1196898752 1196898756
Species Human (GRCh38) Human (GRCh38)
Location X:120362657-120362679 X:120362706-120362728
Sequence CCAGCTGCTCTCTTTCTAAAGTA TAGAATCCCCAATAGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225} {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!