ID: 1197011473_1197011478

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1197011473 1197011478
Species Human (GRCh38) Human (GRCh38)
Location X:121569937-121569959 X:121569974-121569996
Sequence CCACGTGGCATGGAGAGAGAATC AGGGAAAGTACAATGATTGTGGG
Strand - +
Off-target summary {0: 3, 1: 22, 2: 38, 3: 84, 4: 205} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!